Immunomodulatory activity of a Chinese herbal drug Yi Shen Juan Bi in adjuvant arthritis,Pathirage Kamal Perera1, Yunman Li1, Cheng Peng1, Weirong Fang1, Caifeng Han2, : Indian Journal of Pharmacology

Home

RESEARCH ARTICLE	[Download PDF]

Year : 2010 \| Volume : 42 \| Issue : 2 \| Page : 65--69

Immunomodulatory activity of a Chinese herbal drug Yi Shen Juan Bi in adjuvant arthritis

Pathirage Kamal Perera¹, Yunman Li¹, Cheng Peng¹, Weirong Fang¹, Caifeng Han²,
¹ Department of Physiology and Pharmacology, China Pharmaceutical University, Mailbox 207 Tongjiaxiang 24, Nanjing, Jiangsu, 210009, People's Republic of China
² Jiangsu Chiatai Qingjiang Pharmaceutical Co., Ltd. Huaian Jiangsu, People's Republic of China

Correspondence Address:
Yunman Li
Department of Physiology and Pharmacology, China Pharmaceutical University, Mailbox 207 Tongjiaxiang 24, Nanjing, Jiangsu, 210009, People«SQ»s Republic of China

Abstract

Objective: To investigate the immunomodulating mechanisms of a Chinese herbal medicine Yi Shen Juan Bi (YJB) in treatment of adjuvant arthritis (AA) in rats. Materials and Methods: Levels of serum tumor necrosis factor alpha (TNF-α) and interleukin-1β (IL-1β) were measured by the Enzyme-Linked Immunosorbent Assay (ELISA). Expression of TNF-α mRNA and IL-1β mRNA in synovial cells was measured with the semi-quantitative technique of reverse transcription-polymerase chain reaction (RT-PCR), while caspase-3 was examined by western blot analysis. Results: The administration of YJB significantly decreased the production of serum TNF-α and IL-1β. It also decreased significantly the TNF-α mRNA, IL-1β mRNA, and caspase-3 expression in synoviocytes. Conclusions: YJB produces the immunomodulatory effects by downregulating the over-activated cytokines, while it activates caspase-3, which is the key executioner of apoptosis in the immune system. This may be the one of the underlying mechanisms that explains how YJB treats the rheumatoid arthritis.

How to cite this article:
Perera PK, Li Y, Peng C, Fang W, Han C. Immunomodulatory activity of a Chinese herbal drug Yi Shen Juan Bi in adjuvant arthritis.Indian J Pharmacol 2010;42:65-69

How to cite this URL:
Perera PK, Li Y, Peng C, Fang W, Han C. Immunomodulatory activity of a Chinese herbal drug Yi Shen Juan Bi in adjuvant arthritis. Indian J Pharmacol [serial online] 2010 [cited 2023 Jun 10 ];42:65-69
Available from: https://www.ijp-online.com/text.asp?2010/42/2/65/64489

Full Text

Introduction

Rheumatoid arthritis (RA) is a chronic inflammatory disease characterized by fibroblastic proliferation, infiltration of the synovial lining by inflammatory cells which leads to expression of proinflammatory cytokines, and a paucity of apoptosis resulting in bone and joint destruction. [1],[2] For the treatment of RA, traditional Chinese medicines (TCM) were found to be effective clinically, although the mechanisms underlying their efficacy have not yet been fully studied. [3]

Yi Shen Juan Bi (YJB, dark brown pills, patent number: ZL200510040550) is a compound anti-rheumatic herbal drug. YJB formula has been recognized as a valuable traditional medicine used in the treatment of RA. Clinically, YJB has been shown to ameliorate symptoms and signs of RA and decreases the erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), and the rheumatic factor (RF). [4] However, the mechanisms underlying the efficacy of YJB have not yet been fully studied. Therefore, we have studied the pharmacological actions and mechanisms of YJB using an animal model of the disease. In this study, we used adjuvant arthritis (AA) in rat as an experimental model. Important features of this model are chronic synovitis, including inflammatory cell infiltration, panes formation, destruction of cartilage, and bone erosion. [5] Such characteristics of AA are useful in evaluation of the efficacy of therapeutic agents and the underlying mechanisms.

One of the aims of this study was to investigate the effects of YJB on immunomodulatory cytokine production and the mechanism by which YJB affects the process of AA. For that purpose we have examined the production of serum cytokines by the enzyme-linked immunosorbent assay (ELISA). In order to explore further, we have studied the synovial expression of tumor necrosis factor alpha (TNF-α) mRNA, and IL-1β mRNA by using RT-PCR. Apoptosis plays a key role in the imbalance between proliferation and growth arrest of synoviocytes in RA. In this experiment, we have also observed the effect of YJB on proliferation of synovium by inducing apoptosis of synovial cells.

Materials and Methods

Ingredients and Preparation of Yi Shen Juan Bi

The ingredients [Table 1] were concentrated to 1 kg by the method described below.

Scorpio and Scolopendra were pulverized to fine powder and sifted. Radix Angelica and Rhizoma Corydalis were heated under reflux with 60% ethanol for one hour, each time twice and then filtered. Ethanol was recovered and the filtrate concentrated to a thin extract with a relative density of 1.2 (50°C). The decoction of other ingredients was made in water thrice, 2h for the first time and 1.5 h for the second and third times. The decoction was mixed and filtered. The filtrate was concentrated to the relative density of 1.2 (50°C). Ethyl alcohol was added to prepare a solution containing 50% of ethanol and kept aside. The supernatant was separated and ethanol was recovered and then concentrated to a thin extract with a relative density of 1.2 (50°C). Then fine powder, thin extract, and a quantity of excipients were mixed well and made to a concentrated pill, dried, and polished. YJB pills were suspended in 0.5% sodium carboxymethylcellulose (CMC-Na). Cyclophosphamide (CPA), (Jiangsu Hengrui Medicine Co., Ltd, batch number - 07012821) was dissolved in distilled water.

Animals

Male Spargue-Dawley (SD) rats, weighing 180-220 g, were purchased from experimental animal laboratory of Nantong University, China. All of them were acclimatized under standard laboratory conditions. During the experimental period, the animals were kept in a temperature-controlled environment (22΁2°C, 55΁5% relative humidity with a 12 h: 12 h light-dark cycle) and fed with standard laboratory chow and water.

All experimental protocols described in this study were approved by the University Ethics Committee on Animal Research and conformed to the National Institute of Health Guideline for Care and Use of Laboratory Animals.

Drug Treatment and Induction of AA

Rats were divided randomly into six groups: the control group, the model group, the positive control group (CPA, 7 mg/kg), YJB high dose (YJB-H, 2.4 g/kg), middle dose (YJB-M, 1.2 g/kg), and low dose (YJB-L, 0.6 g/kg). Each rat was injected with 0.1 ml of Freund's complete adjuvant (Sigma) intradermally in the left hind metatarsal footpad for inducing inflammation (except the normal control group). On the 14 th day, each group was treated with medication by intragastric administration once daily for next 14 days. The model group was treated with sodium carboxymethylcellulose and the control animals were given an equal volume of distilled water.

The ELISA of TNF-α and IL-1β

After 14 days of medication, blood samples were drawn from orbital plexus for preparation of the serum ELISA test and then killed by cervical dislocation. TNF-α, IL-1β quantitative ELISA kits were purchased from Jingmei Biotech Co. Ltd (Beijing, China). The ELISA was performed according to the manufacturer's instructions.

Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Experiments

Extraction of total RNA

After 14 days of medication, the rats were killed by cervical dislocation and synovial tissue of knee joints was extracted and then total RNA of synovial cells was estimated as directed.

Primer (Designed by Nanjing Sunshine Biotechnology Co. Ltd.)

TNF-α: Leading strand: 5' GCCAATGGCATGGATCTCAAAG3'

Lagging strand: 5' CAGAGCAATGACTCCAAAGT3'

Enhanced products: 357 bp

IL-1β: Leading strand: 5' GAAGCTGTGGCAGCTACCTATGTCT3'

Lagging strand: 5' CTCTGCTTGAGAGGTGCTGATGTAC3'

Enhanced products: 520 bp

GAPDH: Leading strand: 5' GGTGCTGAGTATGTCGTGGAG 3'

Lagging strand: 5' ATGCAGGGATGATGTTCTGG 3'

Enhanced products: 356 bp

Method of RT-PCR

2 μg RNA sample and 1 μg oligo dT15 were mixed in a 200 μL PCR tube without RNase, and then water was added up to 15 μL. After reacting for 5 min at 70°C, these were put into ice. The reverse transcription was conducted using Promeger products (5.0 μL, M-MLV 5Χ Buffer; 1.25 μL, DNTPs (10 mM); 1.25 μL, RNase inhibitor (20 U/μL); 1 μL, 200 U M-MLV RT; 1.5 μL, H2O). The sample was centrifuged quickly, and then placed at 42°C for 60 min, and amplified or frozen at -20°C. PCR was performed by adding the PCR mixture (volume of 20 μL) (2 μL, 10ΧB; 0.4 μL, 10 mM dNTP; 1 μL, 10 μM up and downstream primers; 1.2 μL, 25 mM MgCl2; 0.2 μL, DNA Taq polymerase; 1 μL, cDNA; 13.2 μL, H2O). The reaction mixture was then subjected to 30 cycles of 95°C for 5-min pre-apomorphosis, 94°C for 30-s apomorphosis, 60°C for 30-s anneals and 72°C for 1-min extension. After the last cycle, a final extension at 72°°C for 5 min was done. Then 7 μL PCR product was added to 1.5% agarose gel electrophoresis. The gel was photographed and analyzed by JEDA. The relative content of each sample was computed and compared with internal consulting. The average OD value of the strap of amplified products was determined.

Western blot analysis

After continuous intragastric administration of drugs for 14 days, the rats were killed by cervical dislocation and synovial tissues of knee joints were extracted. After treatment with different reagents as described in the figure legends, synovial tissues were homogenised in M2 buffer (20 mM Tris (SIGMA) pH 7.6, 0.5% NP-40, 250 mM NaCl, 3 mM EDTA, 3 mM EGTA, 2 mM DTT, 0.5 mM PMSF, 20 mM beta-glycerol phosphate, 1 mM sodium vanadate, 1 mg/mL leupeptin). Fifty to eighty micrograms of the lysates were subjected to sodium dodecyl sulfate (SDS) polyacrylamide gel (12%) which was purchased from Ameresco and blotted onto the PVDF membrane. After blocking with 5% skimmed milk in PBST, the membrane was probed with the relevant antibodies, anti-caspase-3 (BD Pharmingens, San Diego, CA.) and α-Tubulin antibodies (Santa Cruz Biotechnology, Santa Cruz, CA). Then the blotted and washed membrane was visualized by enhanced chemiluminescence (ECL), according to the manufacturer's instructions (Amersham, Piscataway, NJ, USA).

Statistical Analysis

The results were expressed as mean ΁ S.D. for each group. Data were assessed by one-way ANOVA followed by Tukey post hoc test, and a value of P The Effect of YJB on TNF-α and IL-1β

As shown in [Figure 1], serum TNF-α and IL-1β levels in AA rats were significantly elevated in the model group compared with control. However, a significant decrease was seen in these parameters in the YJB-treated groups.

The Effect of YJB on the TNF-0α mRNA and IL-1β mRNA Expression

As shown in [Figure 2],[Figure 3],[Figure 4], synovial TNF-α mRNA and IL-1β mRNA expression in AA rats was significantly elevated in the model group compared with control. In YJB-treated group, a significant decrease in these parameters was seen. CPA also significantly decreased these values.

The Effect of YJB on the Expression of caspase-3 precursor (procaspase-3)

As shown in [Figure 5] and [Figure 6], synovial level of caspase-3 precursor (procaspase-3) expression was significantly decreased in the model group compared to control. Compared with the model group, YJB group showed a significant decrease in synovial levels of caspase-3 precursor (procaspase-3) expression. Positive drug, CPA, also significantly decreased it.

Discussion

The contribution made by proinflammatory cytokines in RA, such as tumor necrosis factor TNF-α and IL-1 has been validated in preclinical animal models and in humans. [6] It is also well documented that IL-1 and TNF-α synergistically mediate synovitis and destruction of cartilage and bone. [7] TNF-α is an important factor in inflammation and immunity that can stimulate the synoviocyte and cartilage cells to synthesize the PGE 2 and collagenase causing synovium and cartilage destruction as well as those of IL-1, IL-6, and IL-8. [8] Therefore, it is one of the most important factors in the cytokine network.

In RA patients, IL-1β is overexpressed in inflamed synovial tissue, in particular in the lining layer and in sublining cells [9] and it is elevated in draining lymph from affected joints. [10] Furthermore, cartilage from arthritis patients exhibits upregulation of IL-1β mRNA as compared with normal. [11],[12] In addition, increased production of IL-1β in fibroblast-like synoviocytes of susceptible individuals may lead to a higher risk of developing severe joint damage even in the absence of systemic inflammation. In general, TNF-α causes early joint swelling in RA, while IL-1β-combined the immune complex leads to the cartilage erosion. [13] Considering these investigations it can be concluded that TNF-α and IL-1β have a pivotal role in the pathogenesis of RA. It can also be pointed out that blocking of both TNF-α and IL-1β is necessary in the treatment of RA.

The study revealed that serum levels of TNF-α and IL-1β in the model group were significantly higher than that of normal rats. In addition, TNF-α mRNA and IL-1β mRNA expression in synovial cells of the model group were significantly higher than that of normal rats. These observations correlate well with the above-mentioned research findings in RA. Pro-inflammatory cytokines, such as tumor necrosis factor α and interleukin-1β, are expressed in the arthritic joints in both AA rats and human rheumatoid arthritis, and blockade of these molecules results in amelioration of disease. [14] Our results confirm that YJB could significantly reduce the level of TNF-α and IL-1β levels in serum, while they decrease the TNF-α mRNA and IL-1β mRNA expression in synovial cells. This may be one of the underlying mechanisms of amelioration of inflammation in RA by YJB. Therefore it seems to be a promising drug for the treatment of cytokine expression in vivo.

Currently it is believed that the injuries of osteochondral tissues in RA are closely associated with activation and proliferation of synovial cells. Apoptosis may play a significant role in its pathogenesis. [15] Caspase belongs to the protease family which plays an important role in cell apoptosis. Apoptotic effects of caspases include two pathways. [16],[17] The inductors are different in these two, but they both gather at the downstream caspases inducing cell apoptosis. In general, caspase-3 is a key enzyme for apoptotic cell death and is recognized as a terminator for cells to be killed. [18] We have used purified mouse anti-caspase-3 antibody for detecting caspase-3 levels. This antibody recognizes the mouse 32 kDa pro-caspase-3, which is related to active caspase 3. Active caspase-3 is a homodimer of heterodimers, produced by cleavage of procaspase-3. [19],[20] Our results showed that, pro-caspase-3 in synovial tissue of AA rats in the model group was lower than the normal control group. This suggests that there is a certain degree of apoptosis in synoviocytes in the model group. Compared to the drug-treated groups, there may be an excessive proliferation and inadequate apoptosis leading to the inflammatory response [21] in AA rats. After the treatment with YJB in AA rats, procaspase-3 decreased significantly. It indicates that the increase of apoptosis cells improved the imbalance of excessive proliferation and apoptosis. The agent that induces apoptosis of synoviocytes provides a novel and effective treatment for RA. [22] These findings suggest that YJB induces apoptosis through activation of caspase-3 in AA and may represent a potent drug in RA therapy.

In conclusion, our results have confirmed that YJB possesses an immunomodulatory activity by regulating the key cytokines and also it potently induces the apoptosis of synoviocytes of AA rats, which may be mediated by up-regulating the expression of apoptosis-associated caspase-3. This may be one of the underlying mechanisms that explain how YJB treats the rheumatoid arthritis. However, we believe that further understanding of the mechanism of YJB action should be beneficial for the development of an effective drug for RA.

References

1	Kurowska M, Rudnicka W, Kontny E, Janicka I, Chorazy M, Kowalczewski J , et al. Fibroblast-like synoviocytes from rheumatoid arthritis patients express functional IL-15 receptor complex: Endogenous IL-15 in autocrine fashion enhances cell proliferation and expression of Bcl-x(L) and Bcl-2. J Immunol 2002;169:1760-7.
2	Smolen J, Aletaha D. The burden of rheumatoid arthritis and access to treatment: A medical overview. Eur J Health Econ 2008;8:39-47.
3	Wang JF, Cai CZ, Kong CY, Cao ZW, Chen YZ. A computer method for validating traditional Chinese medicine herbal prescriptions. Am J Chin Med 2005;33:281-97.
4	Li S, Hu X, Jing Z. Therapeutic effect of Yi Shen Juan Bi pill on Rheumatoid Arthritis. Zhejiang Clin Med J 2008;10:628-9.
5	Ding CH, Li Q, Xiong ZY, Zhou AW, Jones G, Xu SY. Oral administration of type II collagen suppresses pro-inflammatory mediator production by synoviocytes in rats with adjuvant arthritis. Clin Exp Immunol 2003;132:416-23.
6	Dinarello CA. The IL-1 family and inflammatory diseases. Clin Exp Rheumatol 2002;20:1-13.
7	Choy EH, Isenberg DA, Garrood T, Farrow S, Ioannou Y, Bird H, et al. Therapeutic benefit of blocking interleukin-6 activity with an anti-interleukin-6 receptor monoclonal antibody in rheumatoid arthritis: A randomized, double-blind, placebo-controlled, dose-escalation trial. Arthritis Rheum 2002;46:3143-50.
8	Choy EH, Panayi GS. Cytokine pathways and joint inflammation in rheumatoid arthritis. N Engl J Med 2001;344:907-16.
9	Lipsky PE, van der Heijde DM, St Clair EW, Furst DE, Breedveld FC, Kalden JR, et al. Infliximab and methotrexate in the treatment of rheumatoid arthritis: Anti-tumor necrosis factor trial in rheumatoid arthritis with concomitant therapy study group. N Engl J Med 2000;343:1594-602.
10	Olszewski WL, Pazdur J, Kubasiewicz E, Zaleska M, Cooke CJ, Miller NE. Lymph draining from foot joints in rheumatoid arthritis provides insight into local cytokine and chemokine production and transport to lymph nodes. Arthritis Rheum 2001;44:541-9.
11	Nadiv O, Beer Y, Goldberg M, Agar G, Loos M, Katz Y. Decreased induction of IL-1β in fibroblast-like synoviocytes: A possible regulatory mechanism maintaining joint homeostasis. Mol Immunol 2007 ; 44:3147-54.
12	Alten R, Gram H, Joosten LA, van den Berg WB, Sieper J, Wassenberg S, et al. The human anti-IL-1β monoclonal antibody ACZ885 is effective in joint inflammation models in mice and in a proof-of-concept study in patients with rheumatoid arthritis. Arthritis Res Ther 2008;10:67.
13	Van den Berg WB. Anti-cytokine therapy in chronic destructive arthritis. Arthritis Res 2001;3:18-26.
14	Van den Berg WB. Is there a rationale for combined TNF and IL-1 blocking in arthritis? Clin Exp Rheumatol 2002;20:21-5.
15	Kaubuyama Y, Kitamura T, Yamaki J, Homma MK, Kikuchi S, Homma Y. Involvement of thioredoxin reductase 1 in the regulation of redox balance and viability of rheumatoid synovial cells. Biochem Biophys Res 2008;367:491-6.
16	Schulze-Osthoff K, Ferrari D, Los M, Wesselborg S, Peter ME. Apoptosis signaling by death receptors. Eur J Biochem 1998;254:439-59.
17	Stepczynska A, Lauber K, Engels IH, Janssen O, Kabelitz D, Wesselborg S. Staurosporine and conventional anticancer drugs induce overlapping, yet distinct pathways of apoptosis and caspase activation. Oncogene 2001;20:1193-202.
18	Berry M, Gonzalez AM, Clarke W, Greenlees L, Barrett L, Tsang W, et al. Sustained effects of gene activated matrices after CNS injury. Mol Cell Neurosci 2001;17:706-16.
19	Boatright KM, Salvesen GS. Mechanisms of caspase activation. Curr Opin Cell Biol 2003;15:725-31.
20	Liu H, Chang DW, Yang X. Interdimer processing and linearity of procaspase-3 activation. A unifying mechanism for the activation of initiator and effector caspases. J Biol Chem 2005;280:11578-82.
21	Afeltra A. Treatment of rheumatoid arthritis: New therapeutic approaches with biological agents. Curr Drug Targets Immune Endocr Metabol Disord 2001;1:45-65.
22	Huang XY, Chen FH, Li J, Xia LJ, Liu YJ, Zhang XM, et al. Mechanism of fibroblast-like synoviocyte apoptosis induced by recombinant human endostatin in rats with adjuvant arthritis. Anat Rec 2008;291:1029-37.