IPSIndian Journal of Pharmacology
Home  IPS  Feedback Subscribe Top cited articles Login 
Users Online : 1655 
Small font sizeDefault font sizeIncrease font size
Navigate Here
  Search
 
  Next article
  Previous article 
  Table of Contents
  
Resource Links
   Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
   Article in PDF (584 KB)
   Citation Manager
   Access Statistics
   Reader Comments
   Email Alert *
   Add to My List *
* Registration required (free)

 
In This Article
   Abstract
   Introduction
   Materials and Me...
   Results
   Discussion
   References
   Article Figures
   Article Tables

 Article Access Statistics
    Viewed4953    
    Printed169    
    Emailed1    
    PDF Downloaded656    
    Comments [Add]    
    Cited by others 14    

Recommend this journal

 


 
RESEARCH ARTICLE
Year : 2010  |  Volume : 42  |  Issue : 2  |  Page : 65-69
 

Immunomodulatory activity of a Chinese herbal drug Yi Shen Juan Bi in adjuvant arthritis


1 Department of Physiology and Pharmacology, China Pharmaceutical University, Mailbox 207 Tongjiaxiang 24, Nanjing, Jiangsu, 210009, People's Republic of China
2 Jiangsu Chiatai Qingjiang Pharmaceutical Co., Ltd. Huaian Jiangsu, People's Republic of China

Date of Submission23-Apr-2009
Date of Decision23-Jun-2009
Date of Acceptance14-Apr-2010
Date of Web Publication23-Jun-2010

Correspondence Address:
Yunman Li
Department of Physiology and Pharmacology, China Pharmaceutical University, Mailbox 207 Tongjiaxiang 24, Nanjing, Jiangsu, 210009, People's Republic of China

Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0253-7613.64489

Rights and Permissions

  Abstract 

Objective: To investigate the immunomodulating mechanisms of a Chinese herbal medicine Yi Shen Juan Bi (YJB) in treatment of adjuvant arthritis (AA) in rats.
Materials and Methods: Levels of serum tumor necrosis factor alpha (TNF-α) and interleukin-1β (IL-1β) were measured by the Enzyme-Linked Immunosorbent Assay (ELISA). Expression of TNF-α mRNA and IL-1β mRNA in synovial cells was measured with the semi-quantitative technique of reverse transcription-polymerase chain reaction (RT-PCR), while caspase-3 was examined by western blot analysis.
Results: The administration of YJB significantly decreased the production of serum TNF-α and IL-1β. It also decreased significantly the TNF-α mRNA, IL-1β mRNA, and caspase-3 expression in synoviocytes.
Conclusions: YJB produces the immunomodulatory effects by downregulating the over-activated cytokines, while it activates caspase-3, which is the key executioner of apoptosis in the immune system. This may be the one of the underlying mechanisms that explains how YJB treats the rheumatoid arthritis.


Keywords: Synoviocytes, TNF-α, IL-1β, caspase-3


How to cite this article:
Perera PK, Li Y, Peng C, Fang W, Han C. Immunomodulatory activity of a Chinese herbal drug Yi Shen Juan Bi in adjuvant arthritis. Indian J Pharmacol 2010;42:65-9

How to cite this URL:
Perera PK, Li Y, Peng C, Fang W, Han C. Immunomodulatory activity of a Chinese herbal drug Yi Shen Juan Bi in adjuvant arthritis. Indian J Pharmacol [serial online] 2010 [cited 2019 Dec 6];42:65-9. Available from: http://www.ijp-online.com/text.asp?2010/42/2/65/64489



  Introduction Top


Rheumatoid arthritis (RA) is a chronic inflammatory disease characterized by fibroblastic proliferation, infiltration of the synovial lining by inflammatory cells which leads to expression of proinflammatory cytokines, and a paucity of apoptosis resulting in bone and joint destruction. [1],[2] For the treatment of RA, traditional Chinese medicines (TCM) were found to be effective clinically, although the mechanisms underlying their efficacy have not yet been fully studied. [3]

Yi Shen Juan Bi (YJB, dark brown pills, patent number: ZL200510040550) is a compound anti-rheumatic herbal drug. YJB formula has been recognized as a valuable traditional medicine used in the treatment of RA. Clinically, YJB has been shown to ameliorate symptoms and signs of RA and decreases the erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), and the rheumatic factor (RF). [4] However, the mechanisms underlying the efficacy of YJB have not yet been fully studied. Therefore, we have studied the pharmacological actions and mechanisms of YJB using an animal model of the disease. In this study, we used adjuvant arthritis (AA) in rat as an experimental model. Important features of this model are chronic synovitis, including inflammatory cell infiltration, panes formation, destruction of cartilage, and bone erosion. [5] Such characteristics of AA are useful in evaluation of the efficacy of therapeutic agents and the underlying mechanisms.

One of the aims of this study was to investigate the effects of YJB on immunomodulatory cytokine production and the mechanism by which YJB affects the process of AA. For that purpose we have examined the production of serum cytokines by the enzyme-linked immunosorbent assay (ELISA). In order to explore further, we have studied the synovial expression of tumor necrosis factor alpha (TNF-α) mRNA, and IL-1β mRNA by using RT-PCR. Apoptosis plays a key role in the imbalance between proliferation and growth arrest of synoviocytes in RA. In this experiment, we have also observed the effect of YJB on proliferation of synovium by inducing apoptosis of synovial cells.


  Materials and Methods Top


Ingredients and Preparation of Yi Shen Juan Bi

The ingredients [Table 1] were concentrated to 1 kg by the method described below.

Scorpio and Scolopendra were pulverized to fine powder and sifted. Radix Angelica and Rhizoma Corydalis were heated under reflux with 60% ethanol for one hour, each time twice and then filtered. Ethanol was recovered and the filtrate concentrated to a thin extract with a relative density of 1.2 (50C). The decoction of other ingredients was made in water thrice, 2h for the first time and 1.5 h for the second and third times. The decoction was mixed and filtered. The filtrate was concentrated to the relative density of 1.2 (50C). Ethyl alcohol was added to prepare a solution containing 50% of ethanol and kept aside. The supernatant was separated and ethanol was recovered and then concentrated to a thin extract with a relative density of 1.2 (50C). Then fine powder, thin extract, and a quantity of excipients were mixed well and made to a concentrated pill, dried, and polished. YJB pills were suspended in 0.5% sodium carboxymethylcellulose (CMC-Na). Cyclophosphamide (CPA), (Jiangsu Hengrui Medicine Co., Ltd, batch number - 07012821) was dissolved in distilled water.

Animals

Male Spargue-Dawley (SD) rats, weighing 180-220 g, were purchased from experimental animal laboratory of Nantong University, China. All of them were acclimatized under standard laboratory conditions. During the experimental period, the animals were kept in a temperature-controlled environment (22΁2C, 55΁5% relative humidity with a 12 h: 12 h light-dark cycle) and fed with standard laboratory chow and water.

All experimental protocols described in this study were approved by the University Ethics Committee on Animal Research and conformed to the National Institute of Health Guideline for Care and Use of Laboratory Animals.

Drug Treatment and Induction of AA

Rats were divided randomly into six groups: the control group, the model group, the positive control group (CPA, 7 mg/kg), YJB high dose (YJB-H, 2.4 g/kg), middle dose (YJB-M, 1.2 g/kg), and low dose (YJB-L, 0.6 g/kg). Each rat was injected with 0.1 ml of Freund's complete adjuvant (Sigma) intradermally in the left hind metatarsal footpad for inducing inflammation (except the normal control group). On the 14 th day, each group was treated with medication by intragastric administration once daily for next 14 days. The model group was treated with sodium carboxymethylcellulose and the control animals were given an equal volume of distilled water.

The ELISA of TNF-α and IL-1β

After 14 days of medication, blood samples were drawn from orbital plexus for preparation of the serum ELISA test and then killed by cervical dislocation. TNF-α, IL-1β quantitative ELISA kits were purchased from Jingmei Biotech Co. Ltd (Beijing, China). The ELISA was performed according to the manufacturer's instructions.

Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Experiments

Extraction of total RNA

After 14 days of medication, the rats were killed by cervical dislocation and synovial tissue of knee joints was extracted and then total RNA of synovial cells was estimated as directed.

Primer (Designed by Nanjing Sunshine Biotechnology Co. Ltd.)

TNF-α: Leading strand: 5' GCCAATGGCATGGATCTCAAAG3'

Lagging strand: 5' CAGAGCAATGACTCCAAAGT3'

Enhanced products: 357 bp

IL-1β: Leading strand: 5' GAAGCTGTGGCAGCTACCTATGTCT3'

Lagging strand: 5' CTCTGCTTGAGAGGTGCTGATGTAC3'

Enhanced products: 520 bp

GAPDH: Leading strand: 5' GGTGCTGAGTATGTCGTGGAG 3'

Lagging strand: 5' ATGCAGGGATGATGTTCTGG 3'

Enhanced products: 356 bp

Method of RT-PCR

2 μg RNA sample and 1 μg oligo dT15 were mixed in a 200 μL PCR tube without RNase, and then water was added up to 15 μL. After reacting for 5 min at 70C, these were put into ice. The reverse transcription was conducted using Promeger products (5.0 μL, M-MLV 5Χ Buffer; 1.25 μL, DNTPs (10 mM); 1.25 μL, RNase inhibitor (20 U/μL); 1 μL, 200 U M-MLV RT; 1.5 μL, H2O). The sample was centrifuged quickly, and then placed at 42C for 60 min, and amplified or frozen at -20C. PCR was performed by adding the PCR mixture (volume of 20 μL) (2 μL, 10ΧB; 0.4 μL, 10 mM dNTP; 1 μL, 10 μM up and downstream primers; 1.2 μL, 25 mM MgCl2; 0.2 μL, DNA Taq polymerase; 1 μL, cDNA; 13.2 μL, H2O). The reaction mixture was then subjected to 30 cycles of 95C for 5-min pre-apomorphosis, 94C for 30-s apomorphosis, 60C for 30-s anneals and 72C for 1-min extension. After the last cycle, a final extension at 72C for 5 min was done. Then 7 μL PCR product was added to 1.5% agarose gel electrophoresis. The gel was photographed and analyzed by JEDA. The relative content of each sample was computed and compared with internal consulting. The average OD value of the strap of amplified products was determined.

Western blot analysis

After continuous intragastric administration of drugs for 14 days, the rats were killed by cervical dislocation and synovial tissues of knee joints were extracted. After treatment with different reagents as described in the figure legends, synovial tissues were homogenised in M2 buffer (20 mM Tris (SIGMA) pH 7.6, 0.5% NP-40, 250 mM NaCl, 3 mM EDTA, 3 mM EGTA, 2 mM DTT, 0.5 mM PMSF, 20 mM beta-glycerol phosphate, 1 mM sodium vanadate, 1 mg/mL leupeptin). Fifty to eighty micrograms of the lysates were subjected to sodium dodecyl sulfate (SDS) polyacrylamide gel (12%) which was purchased from Ameresco and blotted onto the PVDF membrane. After blocking with 5% skimmed milk in PBST, the membrane was probed with the relevant antibodies, anti-caspase-3 (BD Pharmingens, San Diego, CA.) and α-Tubulin antibodies (Santa Cruz Biotechnology, Santa Cruz, CA). Then the blotted and washed membrane was visualized by enhanced chemiluminescence (ECL), according to the manufacturer's instructions (Amersham, Piscataway, NJ, USA).

Statistical Analysis

The results were expressed as mean ΁ S.D. for each group. Data were assessed by one-way ANOVA followed by Tukey post hoc test, and a value of P < 0.05 was considered to be statistically significant.


  Results Top


The Effect of YJB on TNF-α and IL-1β

As shown in [Figure 1], serum TNF-α and IL-1β levels in AA rats were significantly elevated in the model group compared with control. However, a significant decrease was seen in these parameters in the YJB-treated groups.

The Effect of YJB on the TNF-0α mRNA and IL-1β mRNA Expression

As shown in [Figure 2],[Figure 3],[Figure 4], synovial TNF-α mRNA and IL-1β mRNA expression in AA rats was significantly elevated in the model group compared with control. In YJB-treated group, a significant decrease in these parameters was seen. CPA also significantly decreased these values.

The Effect of YJB on the Expression of caspase-3 precursor (procaspase-3)

As shown in [Figure 5] and [Figure 6], synovial level of caspase-3 precursor (procaspase-3) expression was significantly decreased in the model group compared to control. Compared with the model group, YJB group showed a significant decrease in synovial levels of caspase-3 precursor (procaspase-3) expression. Positive drug, CPA, also significantly decreased it.


  Discussion Top


The contribution made by proinflammatory cytokines in RA, such as tumor necrosis factor TNF-α and IL-1 has been validated in preclinical animal models and in humans. [6] It is also well documented that IL-1 and TNF-α synergistically mediate synovitis and destruction of cartilage and bone. [7] TNF-α is an important factor in inflammation and immunity that can stimulate the synoviocyte and cartilage cells to synthesize the PGE 2 and collagenase causing synovium and cartilage destruction as well as those of IL-1, IL-6, and IL-8. [8] Therefore, it is one of the most important factors in the cytokine network.

In RA patients, IL-1β is overexpressed in inflamed synovial tissue, in particular in the lining layer and in sublining cells [9] and it is elevated in draining lymph from affected joints. [10] Furthermore, cartilage from arthritis patients exhibits upregulation of IL-1β mRNA as compared with normal. [11],[12] In addition, increased production of IL-1β in fibroblast-like synoviocytes of susceptible individuals may lead to a higher risk of developing severe joint damage even in the absence of systemic inflammation. In general, TNF-α causes early joint swelling in RA, while IL-1β-combined the immune complex leads to the cartilage erosion. [13] Considering these investigations it can be concluded that TNF-α and IL-1β have a pivotal role in the pathogenesis of RA. It can also be pointed out that blocking of both TNF-α and IL-1β is necessary in the treatment of RA.

The study revealed that serum levels of TNF-α and IL-1β in the model group were significantly higher than that of normal rats. In addition, TNF-α mRNA and IL-1β mRNA expression in synovial cells of the model group were significantly higher than that of normal rats. These observations correlate well with the above-mentioned research findings in RA. Pro-inflammatory cytokines, such as tumor necrosis factor α and interleukin-1β, are expressed in the arthritic joints in both AA rats and human rheumatoid arthritis, and blockade of these molecules results in amelioration of disease. [14] Our results confirm that YJB could significantly reduce the level of TNF-α and IL-1β levels in serum, while they decrease the TNF-α mRNA and IL-1β mRNA expression in synovial cells. This may be one of the underlying mechanisms of amelioration of inflammation in RA by YJB. Therefore it seems to be a promising drug for the treatment of cytokine expression in vivo.

Currently it is believed that the injuries of osteochondral tissues in RA are closely associated with activation and proliferation of synovial cells. Apoptosis may play a significant role in its pathogenesis. [15] Caspase belongs to the protease family which plays an important role in cell apoptosis. Apoptotic effects of caspases include two pathways. [16],[17] The inductors are different in these two, but they both gather at the downstream caspases inducing cell apoptosis. In general, caspase-3 is a key enzyme for apoptotic cell death and is recognized as a terminator for cells to be killed. [18] We have used purified mouse anti-caspase-3 antibody for detecting caspase-3 levels. This antibody recognizes the mouse 32 kDa pro-caspase-3, which is related to active caspase 3. Active caspase-3 is a homodimer of heterodimers, produced by cleavage of procaspase-3. [19],[20] Our results showed that, pro-caspase-3 in synovial tissue of AA rats in the model group was lower than the normal control group. This suggests that there is a certain degree of apoptosis in synoviocytes in the model group. Compared to the drug-treated groups, there may be an excessive proliferation and inadequate apoptosis leading to the inflammatory response [21] in AA rats. After the treatment with YJB in AA rats, procaspase-3 decreased significantly. It indicates that the increase of apoptosis cells improved the imbalance of excessive proliferation and apoptosis. The agent that induces apoptosis of synoviocytes provides a novel and effective treatment for RA. [22] These findings suggest that YJB induces apoptosis through activation of caspase-3 in AA and may represent a potent drug in RA therapy.

In conclusion, our results have confirmed that YJB possesses an immunomodulatory activity by regulating the key cytokines and also it potently induces the apoptosis of synoviocytes of AA rats, which may be mediated by up-regulating the expression of apoptosis-associated caspase-3. This may be one of the underlying mechanisms that explain how YJB treats the rheumatoid arthritis. However, we believe that further understanding of the mechanism of YJB action should be beneficial for the development of an effective drug for RA.

 
  References Top

1.Kurowska M, Rudnicka W, Kontny E, Janicka I, Chorazy M, Kowalczewski J , et al. Fibroblast-like synoviocytes from rheumatoid arthritis patients express functional IL-15 receptor complex: Endogenous IL-15 in autocrine fashion enhances cell proliferation and expression of Bcl-x(L) and Bcl-2. J Immunol 2002;169:1760-7.  Back to cited text no. 1      
2.Smolen J, Aletaha D. The burden of rheumatoid arthritis and access to treatment: A medical overview. Eur J Health Econ 2008;8:39-47.  Back to cited text no. 2      
3.Wang JF, Cai CZ, Kong CY, Cao ZW, Chen YZ. A computer method for validating traditional Chinese medicine herbal prescriptions. Am J Chin Med 2005;33:281-97.  Back to cited text no. 3      
4.Li S, Hu X, Jing Z. Therapeutic effect of Yi Shen Juan Bi pill on Rheumatoid Arthritis. Zhejiang Clin Med J 2008;10:628-9.  Back to cited text no. 4      
5.Ding CH, Li Q, Xiong ZY, Zhou AW, Jones G, Xu SY. Oral administration of type II collagen suppresses pro-inflammatory mediator production by synoviocytes in rats with adjuvant arthritis. Clin Exp Immunol 2003;132:416-23.  Back to cited text no. 5      
6.Dinarello CA. The IL-1 family and inflammatory diseases. Clin Exp Rheumatol 2002;20:1-13.  Back to cited text no. 6      
7.Choy EH, Isenberg DA, Garrood T, Farrow S, Ioannou Y, Bird H, et al. Therapeutic benefit of blocking interleukin-6 activity with an anti-interleukin-6 receptor monoclonal antibody in rheumatoid arthritis: A randomized, double-blind, placebo-controlled, dose-escalation trial. Arthritis Rheum 2002;46:3143-50.  Back to cited text no. 7      
8.Choy EH, Panayi GS. Cytokine pathways and joint inflammation in rheumatoid arthritis. N Engl J Med 2001;344:907-16.  Back to cited text no. 8      
9.Lipsky PE, van der Heijde DM, St Clair EW, Furst DE, Breedveld FC, Kalden JR, et al. Infliximab and methotrexate in the treatment of rheumatoid arthritis: Anti-tumor necrosis factor trial in rheumatoid arthritis with concomitant therapy study group. N Engl J Med 2000;343:1594-602.  Back to cited text no. 9      
10.Olszewski WL, Pazdur J, Kubasiewicz E, Zaleska M, Cooke CJ, Miller NE. Lymph draining from foot joints in rheumatoid arthritis provides insight into local cytokine and chemokine production and transport to lymph nodes. Arthritis Rheum 2001;44:541-9.   Back to cited text no. 10      
11.Nadiv O, Beer Y, Goldberg M, Agar G, Loos M, Katz Y. Decreased induction of IL-1β in fibroblast-like synoviocytes: A possible regulatory mechanism maintaining joint homeostasis. Mol Immunol 2007 ; 44:3147-54.   Back to cited text no. 11      
12.Alten R, Gram H, Joosten LA, van den Berg WB, Sieper J, Wassenberg S, et al. The human anti-IL-1β monoclonal antibody ACZ885 is effective in joint inflammation models in mice and in a proof-of-concept study in patients with rheumatoid arthritis. Arthritis Res Ther 2008;10:67.  Back to cited text no. 12      
13.Van den Berg WB. Anti-cytokine therapy in chronic destructive arthritis. Arthritis Res 2001;3:18-26.  Back to cited text no. 13      
14.Van den Berg WB. Is there a rationale for combined TNF and IL-1 blocking in arthritis? Clin Exp Rheumatol 2002;20:21-5.  Back to cited text no. 14      
15.Kaubuyama Y, Kitamura T, Yamaki J, Homma MK, Kikuchi S, Homma Y. Involvement of thioredoxin reductase 1 in the regulation of redox balance and viability of rheumatoid synovial cells. Biochem Biophys Res 2008;367:491-6.  Back to cited text no. 15      
16.Schulze-Osthoff K, Ferrari D, Los M, Wesselborg S, Peter ME. Apoptosis signaling by death receptors. Eur J Biochem 1998;254:439-59.  Back to cited text no. 16      
17.Stepczynska A, Lauber K, Engels IH, Janssen O, Kabelitz D, Wesselborg S. Staurosporine and conventional anticancer drugs induce overlapping, yet distinct pathways of apoptosis and caspase activation. Oncogene 2001;20:1193-202.  Back to cited text no. 17      
18.Berry M, Gonzalez AM, Clarke W, Greenlees L, Barrett L, Tsang W, et al. Sustained effects of gene activated matrices after CNS injury. Mol Cell Neurosci 2001;17:706-16.  Back to cited text no. 18      
19.Boatright KM, Salvesen GS. Mechanisms of caspase activation. Curr Opin Cell Biol 2003;15:725-31.  Back to cited text no. 19      
20.Liu H, Chang DW, Yang X. Interdimer processing and linearity of procaspase-3 activation. A unifying mechanism for the activation of initiator and effector caspases. J Biol Chem 2005;280:11578-82.  Back to cited text no. 20      
21.Afeltra A. Treatment of rheumatoid arthritis: New therapeutic approaches with biological agents. Curr Drug Targets Immune Endocr Metabol Disord 2001;1:45-65.  Back to cited text no. 21      
22.Huang XY, Chen FH, Li J, Xia LJ, Liu YJ, Zhang XM, et al. Mechanism of fibroblast-like synoviocyte apoptosis induced by recombinant human endostatin in rats with adjuvant arthritis. Anat Rec 2008;291:1029-37.  Back to cited text no. 22      


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6]
 
 
    Tables

  [Table 1]

This article has been cited by
1 Novel Polysaccharide from Radix Cyathulae of?cinalis Kuan Can Improve Immune Response to Ovalbumin in Mice
Feng Haibo,Du Xiaogang,Liu Juan,Han Xingfa,Cao Xiaohan,Zeng Xianyin
International Journal of Biological Macromolecules. 2014;
[Pubmed] | [DOI]
2 Development and assessment of a complete-detoxication strategy for Fuzi (lateral root of Aconitum carmichaeli) and its application in rheumatoid arthritis therapy
Peijian Tong,Chengliang Wu,Xiaofen Wang,Hongzhou Hu,Hongting Jin,Changyu Li,Ying Zhu,Letian Shan,Luwei Xiao
Journal of Ethnopharmacology. 2013; 146(2): 562
[Pubmed] | [DOI]
3 Enhancement of the immune responses to foot-and-mouth disease vaccination in mice by oral administration of a Novel polysaccharide from the roots of Radix Cyathulae officinalis Kuan (RC)
Haibo Feng,Xiaogang Du,Jing Tang,Xiaohan Cao,Xingfa Han,Zhiyu Chen,Yanger Chen,Xianyin Zeng
Cellular Immunology. 2013; 281(2): 111
[Pubmed] | [DOI]
4 Effects of immune synergist of Chinese medicinal herbs on the efficacy of vaccination against classic swine fever
Wang, F., Yan, Y., Zhang, Y., Han, Y., Guan, C.
African Journal of Biotechnology. 2012; 11(6): 1535-1539
[Pubmed]
5 The Protective Effect of Yi Shen Juan Bi Pill in Arthritic Rats with Castration-Induced Kidney Deficiency
Hongyan Zhao,Jian Li,Xiaojuan He,Cheng Lu,Cheng Xiao,Xuyan Niu,Ning Zhao,Dahong Ju,Aiping Lu
Evidence-Based Complementary and Alternative Medicine. 2012; 2012: 1
[Pubmed] | [DOI]
6 The protective effect of Yi Shen Juan Bi Pill in arthritic rats with castration-induced kidney deficiency
Zhao, H., Li, J., He, X., Lu, C., Xiao, C., Niu, X., Zhao, N., (...), Lu, A.
Evidence-based Complementary and Alternative Medicine. 2012; art(102641 )
[Pubmed]
7 Efficacy of static magnetic field for pain of adjuvant arthritis rats
Shigeyuki Kanai,Norimasa Taniguchi
Advances in Bioscience and Biotechnology. 2012; 03(04): 511
[Pubmed] | [DOI]
8 Euonymus alatus extract attenuates LPS-induced NF-?B activation via IKK inhibition in RAW 264.7 cells
Byung Koo Oh,Jihye Mun,Ho Won Seo,Shi Yong Ryu,Young Sup Kim,Byung Ho Lee,Kwang-Seok Oh
Journal of Ethnopharmacology. 2011; 134(2): 288
[Pubmed] | [DOI]
9 Modulation of phenotypic and functional maturation of murine dendritic cells (DCs) by purified Achyranthes bidentata polysaccharide (ABP)
Yaxuan Zou,Jingjuan Meng,Wenna Chen,Jingling Liu,Xuan Li,Weiwei Li,Changlong Lu,Fengping Shan
International Immunopharmacology. 2011; 11(8): 1103
[Pubmed] | [DOI]
10 Modulation of phenotypic and functional maturation of murine dendritic cells (DCs) by purified Achyranthes bidentata polysaccharide (ABP)
Zou, Y., Meng, J., Chen, W., Liu, J., Li, X., Li, W., Lu, C., Shan, F.
International Immunopharmacology. 2011; 11(8): 1103-1108
[Pubmed]
11 Ex vivo and in vivo effect of Chinese herbal pill Yi Shen Juan Bi (YJB) on experimental arthritis
Pathirage Kamal Perera,Cheng Peng,Lv Xue,Yunman Li,Caifeng Han
Journal of Ethnopharmacology. 2011; 134(1): 171
[Pubmed] | [DOI]
12 A traditional Chinese medicine versus Western combination therapy in the treatment of rheumatoid arthritis: Two-stage study protocol for a randomized controlled trial
Zhang, C., Jiang, M., Lu, A.
Trials. 2011; 12(art ): 137
[Pubmed]
13 Euonymus alatus extract attenuates LPS-induced NF-κB activation via IKKβ inhibition in RAW 264.7 cells
Oh, B.K., Mun, J., Seo, H.W., Ryu, S.Y., Kim, Y.S., Lee, B.H., Oh, K.-S.
Journal of Ethnopharmacology. 2011; 134(2): 288-293
[Pubmed]
14 Ex vivo and in vivo effect of Chinese herbal pill Yi Shen Juan Bi (YJB) on experimental arthritis
Perera, P.K., Peng, C., Xue, L., Li, Y., Han, C.
Journal of Ethnopharmacology. 2011; 134(1): 171-175
[Pubmed]



 

Top
Print this article  Email this article

    

Site Map | Home | Contact Us | Feedback | Copyright and Disclaimer
Online since 20th July '04
Published by Wolters Kluwer - Medknow